Health Articles

 

Metformin mitigates the impaired development of skeletal muscle in the offspring of obese mice

Citation: Nutrition and Diabetes (2011) 1, e7; doi:10.1038/nutd.2011.3& 2011 Macmillan Publishers Limited All rights reserved 2044-4052/11 Metformin mitigates the impaired development ofskeletal muscle in the offspring of obese mice JF Tong1, X Yan1, JX Zhao1, MJ Zhu1, PW Nathanielsz2 and M Du1 1Developmental Biology Group, Department of Animal Science, University of Wyoming, Laramie, WY, USA and 2Center forPregnancy and Newborn Research, University of Texas Health Sciences Center, San Antonio, TX, USA Background: Maternal obesity is linked with offspring obesity and type 2 diabetes. Skeletal muscle (SM) insulin resistance iscentral to the development of diabetes. Adenosine monophosphate (AMP)-activated protein kinase (AMPK) is inhibited in SM offetuses born to obese mothers.
Objective: The aim of this study was to evaluate the effect of maternal metformin administration on AMPK activity and reversionof adverse changes in offspring SM of obese mice.
Design: Female weanling C57BL/6J mice received either control diet (CON, 6 mice) or high-fat diet (HFD; OB, 12 mice) for 8weeks before mating. After mating, mice continued receiving their respective CON or OB diets. In addition, 6 of those 12 micefed with fat diet also received metformin administration (2 mg per ml in drinking water) throughout gestation and lactation(MET). After weaning at postnatal 21 days, offspring were fed a HFD to mimic a postnatal obesogenic environment untilnecropsy.
Results: Mothers receiving the fat diet developed obesity. OB offspring showed higher adiposity than CON and MET offspring.
AMPK phosphorylation was lower in SM of OB offspring. b-Catenin and myogenic regulatory factors, MyoD and myogenin, weredownregulated in OB muscle, whereas the adipogenic marker, peroxisome proliferator-activated receptor-g, was upregulatedcompared with CON muscle. Metformin administration prevented these changes in OB offspring SM. OB but not MET offspringdemonstrated glucose intolerance. Mitochondrial content decreased, and activities of citrate synthase and b-hydroxyacyl-CoAdehydrogenase also decreased in OB offspring SM, whereas they were recovered in MET offspring SM.
Conclusion: Maternal metformin administration improves SM development in OB offspring.
Nutrition and Diabetes (2011) 1, e7; published online 16 May 2011 Keywords: developmental programming; maternal obesity; Amp-activated protein kinase; metformin; skeletal muscle Skeletal muscle (SM) is a potential target for antiobese and antidiabetic therapies because it constitutes about 40–50% of Obesity and type 2 diabetes are increasing at alarming rates, body mass and is the main peripheral tissue responsive to even in teenagers and At the same time, the insulin-stimulated uptake of glucose and fatty acids.
prevalence of overweight and obese women of childbearing Development of insulin resistance in SM is an essential step age is a growing public health concern.Western high- in the development of type 2 The fetal stage is energy diets combined with maternal obesity (MO) represent crucial for SM development, because no net increase in the a special problem that can result in harmful, persistent number of muscle fibers occurs after phenotypic outcomes in offspring, including predisposition Fetal SM contains a large number of pluripotent cells.
to obesity and Although accumulating evidence Although the majority of these cells differentiate into muscle from both epidemiological studies and animal studies shows fibers through myogenesis, a portion becomes adipocytes.
that MO predisposes offspring to obesity and diabetes, The canonical Wnt/b-catenin signaling pathway is essential the causative mechanisms have not been elucidated.
for myogenesis.Enhancing Wnt/b-catenin signalingincreases expression of myogenic regulatory factors, includ-ing Myf5 and MyoD,whereas downregulating Wnt/ Correspondence: Dr M Du, Developmental Biology Group, Department of b-catenin signaling pathway promotes adipogenesis by Animal Science, University of Wyoming, 1000 East University Avenue, enhancing the expression of peroxisome proliferator- Laramie, WY 82071, USA.
activated receptor-g (PPAR-g), a key regulator of adipogenesi E-mail: Received 4 August 2010; revised 25 March 2011; accepted 27 March 2011 Enhanced adipogenesis in fetal SM increases intramuscular Maternal obesity, metformin and offspring muscle adipocytes, an event linked to SM insulin resisThus, At weaning, maternal mice were killed, and serum was impairment of fetal SM development will predispose offspring collected for blood profile analyses. The maternal carcasses to diabetes and obesity in later were grounded, and the fat content was analyzed using Folch Adenosine monophosphate (AMP)-activated protein kinase extraction method.After weaning, all offspring were fed (AMPK) is a master controller of energy metabolism in with the HFD (D12451) to mimic a postnatal obesogenic SM.AMPK controls SM development by enhancing the environment until necropsy at 60 days of age.
A separate cohort of 12 female mice were assigned to CON, genesis,both of which link to SM insulin resistance.
OB and MET groups (n ¼ 4) and treated as described above.
Activation of AMPK promotes myogenesis, whereas inhibition Offspring male mice were used for glucose tolerance test.
promotes adipogenesisMetformin is the most commondrug currently in use for treating type 2 diabetes. Metformin'sactivity is mainly mediated by AMPKUsing a maternal Sample collection obese sheep model, we have showed that MO downregulates Offspring were killed on postnatal day 1 (two mice per litter AMPK activity in fetal SM, which is expected to have were killed), day 15 (one male per litter) and day 60 (one profound impact on glucose uptake, insulin signaling and male per litter). Each mouse was skinned and eviscerated.
properties of fetal and offspring SM.Based on these findings, Owing to the small size of the offspring, the muscle from the we hypothesized that activation of fetal SM AMPK by whole hind (after removing skin, bone and visible connec- maternal metformin administration would prevent the tive tissue and fat) was collected from postnatal day-1 mice changes in fetal and offspring SM properties that result from (muscles from 2 mice per litter were pooled) and day-15 male exposure to MO. The objective of the present study was to mice (1 mouse per litter, n ¼ 6 per treatment), frozen in investigate the effects of metformin administration to obese liquid N2 and stored at 80 1C for further analyses. For mothers on offspring SM composition and to assess the postnatal day-60 mice, gastrocnemius muscle and gonadal importance of AMPK in the development of SM.
fat from males (n ¼ 6 per group) were separated, weighed andcollected. Also, a section (from first to last lumbar vertebrae) Materials and methods of trunk from day-1 and -15 mice was embedded in OCTcompound (Sakura Fineteck USA Inc., Torrance, CA, USA), Care and use of animals frozen in liquid N2 and stored in 80 1C for histological examination of muscle structure.
Wilmington, MA, USA) were maintained according to thestandard protocols approved by the University of Wyoming Animal Use and Care Committee. Mice were housed two per Antibodies against AMPKa (cat. number 2532), phospho- cage under a 12-h light/dark cycle (from 0630 to 1830 AMPKa at Ser172 (cat. number 2535) and b-catenin (cat.
hours), with ad libitum access to diet and water. At 4 weeks of number 9587) were purchased from Cell Signaling (Danvers, age, females were randomized to receive either a control diet MA, USA). Antibody against MyoD (cat. number 5117) was (D12450B) with 10% energy from fat (CON) or a high-fat diet purchased from GenScript Corporation (Piscataway, NJ, (HFD; D12451) with 45% energy from fat for 8 weeks.
USA). Antibody against myogenin was obtained from the Control diet (D12450B, a starch, casein and sucrose-based Developmental Studies Hybridoma Bank (University of Iowa, diet containing protein 19.2%, carbohydrate 67.3%, fat 4.3% Iowa City). Antibody against PPAR-g (cat. number DB134) and vitamins 1.0%, 3.85 kcal g1) and high-energy diet was purchased from Delta Biolabs (Gilroy, CA, USA). Anti- (D12451, a lard and sucrose-based diet containing protein body against glyceraldehyde 3-phosphate dehydrogenase 24.0%, carbohydrate 41.0%, fat 24.0% and vitamins 1.0%, was purchased from Ambion Inc. (Austin, TX, USA).
4.73 kcal g1) were purchased from Research Diets (New Secondary antibodies were purchased from LI-COR Bio- Brunswick, NJ, USA). At 3 months of age, mice (6 CON mice sciences (Lincoln, NE, USA).
and 12 high-fat-fed mice) were housed individually andbred. Following mating, all mice continued to receive theirrespective diets until their litters were weaned. The 12 high- Immunoblotting analysis fat-fed mice were further separated into two groups, with one Frozen muscle samples (0.1 g) were homogenized in 500 ml group (n ¼ 6) receiving metformin (Spectrum Chemical MFG extraction buffer containing 20 mM Tris-HCl (pH 7.4), 2% Corp., New Brunswick, NJ, USA) administration (2 mg per ml SDS, 1% Triton X-100, 5.0 mM EDTA, 5.0 mM EGTA, 1 mM in the drinking water, about 350 mg kg1 per day, MET) DTT, 100 mM NaF, 2 mM sodium vanadate, 0.5 mM phenyl- throughout pregnancy and lactation and the other group methylsufonyl fluoride, 10 ml per ml leupeptin and 10 ml per ml pepstatin. Protein concentration was determined using The dosage of metformin is based on a previous study the Bio-Rad DC Protein Assay kit (Bio-Rad, Hercules, CA, The litter size was normalized to six mice per litter. Body USA) and separated by SDS-polyacrylamide gel electro- weight (BW) and diet intake of dams and offspring were phoresis Following electrophoresis, proteins on the gel were monitored twice per week.
transferred to nitrocellulose membranes. After blocking in Nutrition and Diabetes Maternal obesity, metformin and offspring muscleJF Tong et al 50% Odyssey Infrared Imaging blocking buffer (LI-COR TAGATGA (forward) and GAAGAATGTTATGTTTACTCCTAC Biosciences) and 50% phosphate-buffered saline for 60 min, GAATATG (reverse). Mitochondrial DNA copy number was calculated based on the difference in DCt values between antibodies at 4 1C, followed by incubation with infrared Cyt C and UCP2.
dye-conjugated secondary antibodies at room temperaturefor 60 min. Membranes were visualized using an OdysseyInfrared Imaging System (LI-COR Biosciences). Density of Blood profile analyses bands was quantified using the Odyssey Infrared Imaging Serum glucose concentrations were analyzed using Glucose Software Version 2.1 and using glyceraldehyde 3-phosphate Assay Kit (Sigma-Aldrich, Saint Louis, Missouri, USA). Serum dehydrogenase as the internal control.
triglyceride concentrations were analyzed using MouseSerum Serum insulin concentrations and leptin concentrations Hematoxylin and eosin staining were determined by kits (Linco Research, St Charles, MO, Samples of the trunk (first lumbar vertebrae) were cross- USA). All experimental assays were performed according to sectioned at 10-mm thickness using a Reichert HistoStat the manufacturer's instructions.
(Scientific Instruments, Buffalo, NY, USA), stained withhematoxylin and eosin and examined by light microscopy.
Enzyme activity assaysMuscle samples (0.03 g) were homogenized in 1:20 dilution Intraperitoneal glucose tolerance test (wt/vol) of an extraction buffer (0.1 M KH Glucose tolerance test was performed on one male offspring 2 mM EDTA, pH 7.2). Citrate synthase and b-hydroxyacyl- per litter at day 15 and day 60 postnatal. Before the glucose CoA dehydrogenase (b-HAD) activities were assayed spectro- tolerance test, mice were weighed and fasted overnight with photometrically, as described CS and b-HAD ad libitum access to water. The tail tip was nicked with a razor activity were calculated and reported as mmol per min g wet blade, and a small drop of blood was sampled from the tail of weight of muscle.
each mouse by gentle stroking. Baseline blood glucose wasmeasured by the glucose oxidase method using a glucometer(Bayer Contour, Tarrytown, NY, USA). Following the baseline Statistical analysis sampling, 2 g per kg BW of 20% D-glucose was injected into Each litter was considered as an experimental unit. All data the intraperitoneal cavity, and blood glucose measured at were expressed as mean±s.e. Data from each time point 15, 30, 60 and 120 min after injection.
(days 1, 15 and 60) were analyzed independently using theGLM procedure of SAS (SAS Inst. Inc., Cary, NC, USA), andTukey's studentized range test was used for multi-compar- Myosin heavy-chain isoform separation ison to determine significant differences among means.
Homogenates from muscle samples were prepared, and Statistical significance was considered as Po0.05.
myosin heavy-chain isoform distribution was assessed usinggel electrophoresis, as previously described.
Real-time PCR for mitochondrial DNA and genomic DNA copynumber BW and diet consumption of dams and offspring Total DNA was obtained from muscles by an organic solvent There was no difference in maternal BW at the start of extraction-based method, as described previously.DNA dietary treatments (Supplementary Figure 1). At week 8, BW concentration was measured using a Nanodrop 1000 spectro- of HFD dams and CON dams clearly diverged (Po0.05). By photometer (Thermo Scientific, Wilmington, DE, USA), and the end of treatments, BW gain in HFD dams was greater subsequently diluted in water to a final concentration of than CON dams (Po0.05, Supplementary Figure 1). At week 50 ng ml1. Real-time PCR was carried out using an iQ5 4, the diet intake of HFD mice was lower than CON mice. At RT-PCR detection system (Bio-Rad) using SYBR Green weeks 8 and 12, the diet consumption did not differ between RT-PCR kit from Bio-Rad and the following cycle parameters: groups (Supplementary Figure 1).
one cycle of 50 1C for 2 min, and 95 1C for 10 min, followed At weaning (21 days), the OB maternal BW and fat content by 40 cycles at 95 1C for 15 s and 60 1C for 60 s. Melting point were higher in OB and MET groups The circulating dissociation curves and agarose gel electrophoresis were glucose level was higher in OB compared with CON and MET performed to confirm that only a single product was treatments, but there was no difference in the concentra- amplified. The murine genomic DNA was analyzed by tions of insulin and triglyceride in serum. The leptin content measuring the single-copy uncoupling protein 2 (UCP2) was higher for both OB and MET compared with CON mice gene with primers: GCGTTCTGGGTACCATCCTAAC (forward) and GCGACCAGCCCATTGTAGA (reverse). Mitochondrial The birth weight of offspring born to OB and MET mothers DNA was analyzed by measuring cytochrome C oxidase II were heavier than CON mothers (OB mothers, 1.37±0.02 g; (Cyt C) mtDNA gene with primers: TTTTCAGGCTTCACCC MET mothers, 1.35±0.01 g; and CON mothers, 1.26±0.04 g), Nutrition and Diabetes

Maternal obesity, metformin and offspring muscle Maternal BW, fat content and serum profile at weaning Expression of b-catenin and myogenic markers in offspring SMAt day 1, b-catenin protein content tended to be lower in OB offspring muscle (P ¼ 0.07) compared with CON offspring muscle, and was increased by metformin administration Body fat content (%) This difference in b-catenin was maintained in theday-60 gastrocnemius muscle. There was a trend that MyoD protein expression at days 1 (P ¼ 0.06) and 15 were decreased Triglyceride (mg ml1) Glucose (mg dl1) in OB offspring SM (P ¼ 0.09), as well as myogenin at day 1 Insulin (ng ml1) (P ¼ 0.07), indicating that myogenesis might be impaired.
Metformin administration tended to restore MyoD at days 1 Abbreviation: BW, body weight. Mean±s.e. *Po0.05 versus CON and and 15 (P ¼ 0.06 and 0.08, respectively), and myogenin #Po0.05 versus OB. n ¼ 6.
expression at day 15 (P ¼ 0.05, Adipogenesis in offspring SM PPAR-g protein expression was much higher in OB offspring SM compared with CON SM (Po0.05; Metformin administration decreased PPAR-g protein expression com- pared with OB (Po0.05). We next examined the morphology of offspring muscle. There were no obvious adipocytes visible in muscle cross-section at day 1 (but at day 15, mature adipocytes were visible in OB offspring SM; metfor- min inhibited the formation of intramuscular adipocytes in 0 CON OB MET
CON OB MET
CON OB MET
offspring SM induced by the maternal HFD Maternal metformin administration increased glucose uptake of offspringThere were no differences in the glucose concentration Figure 1 AMPK phosphorylation in day-1 and -15 offspring hindleg muscle,and day-60 male offspring gastrocnemius muscle of CON, OB and MET among treatments at a single time point However, mothers. Data are expressed as mean±s.e., n ¼ 6. #Po0.05 versus CON; when the total glucose disposal was compared by combining (#)Po0.1 versus CON; and *Po0.05 versus OB.
the incremental area under the curve, offspring of OB damhad a lower blood glucose disposal rate compared withthose of CON and MET mothers at both days 15 and 60.
whereas there was no difference between OB and MET The improvement of glucose uptake following metformin mothers (Supplementary Figure 2A). Dietary intake did not administration was associated with enhanced Akt signaling differ substantially between groups (Supplementary Figure (Supplementary Figure 3).
2D). OB offspring showed greater weight gain than CONoffspring throughout the experiment whereasMET offspring was intermediate. At day 60, the gonadal fat of Maternal HFD and metformin administration had no effects OB male offspring (1.05±0.17 g) was much heavier than that on muscle fiber type distribution in the offspring SM of CON offspring (0.57±0.06 g, Po0.05) and tended to be Myosin heavy-chain isoforms in postnatal mice muscle were heavier than that of MET offspring (0.74±0.07 g, P ¼ 0.08; separated (Supplementary Figure 4). There are two develop- Supplementary Figures 2B and C).
mental myosin heavy-chain isoforms, namely, embryonicand neonatal myosin heavy-chain isoform, present in new-born mouse gastrocnemius, which are replaced by adultisoforms, including type IIA, IIX and IIB by day 14.As Maternal metformin administration stimulated AMPK activityin offspring SM shown in Supplementary Figure 4, no difference in muscle AMPK was activated in the SM of MET offspring. Phosphor- fiber composition was detected among different treatments ylation of AMPK at Thr 172 in OB offspring SM was reduced at all time points. Also, type I fiber was indistinguishable at compared with CON mothers (Po0.05 at days 15 and 60, day 60 with this gel electrophoresis method.
and P ¼ 0.06 at day 1, The phosphorylation ofAMPK at Thr 172 was rescued in MET offspring SM at the Mitochondria DNA copy number and muscle metabolic activity three time points examined compared with OB offspring SM.
in the offspring was affected by maternal HFD and metformin Using western blotting, no significant difference in the protein content of AMPKa subunit was observed (data not density. Although we found no difference in muscle fiber Nutrition and Diabetes

Maternal obesity, metformin and offspring muscleJF Tong et al CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
CON OB MET
Figure 2 Contents of b-catenin, myogenic markers and PPAR-g in day-1 and -15 offspring hindleg muscle, and day-60 male offspring gastrocnemius muscleof CON, OB and MET mothers. (a) Beta-catenin content; (b) MyoD content; (c) Myogenin content; (d) PPARgamma content. Data are expressed as mean±s.e.,n ¼ 6. #Po0.05 versus CON; (#)Po0.1 versus CON; *Po0.05 versus OB; and (*)Po0.1 versus OB.
Figure 3 Hematoxylin and eosin (H&E) staining of day-1 and -15 offspring muscle of CON, OB and MET mothers. A section of dorsum of the trunk was dissected,embedded in OCT and frozen in liquid N2. Cryofixed muscle specimens were cross-sectioned at 10-um thickness and stained with H&E,  100 magnification.
(a) CON muscle at day 1; (b) OB muscle at day 1; (c) MET muscle at day 1; (d) CON muscle at day 15; (e) OB muscle at day 15; (f) MET muscle at day 15.
composition among different treatments, mitochondrial increased mitochondrial copy number in the offspring at day DNA copy number was decreased in OB offspring at days 15. Moreover, mitochondrial function in offspring SM was 15 and 60 Metformin administration to OB dams affected by maternal HFD and metformin administration, as Nutrition and Diabetes Maternal obesity, metformin and offspring muscle IAUC glucose
IAUC glucose
Blood glucose (mg/dl)
Blood glucose (mg/dl)
Time after glucose injection (min)
Time after glucose injection (min)
Figure 4 Glucose tolerance test (GTT) on postnatal day-15 and -60 offspring of CON, OB, and MET mothers. (a) Intraperitoneal GTT in day-15 male offspringmice. The histogram represents the incremental area under the respective glucose curve. (b) Intraperitoneal GTT in postnatal day-60 male offspring mice. Thehistogram represents the incremental area under the glucose curve. Data are expressed as mean±s.e., n ¼ 4 for both ages. #Po0.05 versus CON; (#)Po0.10 versusCON; *Po0.50 versus OB; and (*)Po0.50 versus OB.
mtDNA copy number, citrate synthase and b-HAD activity in day-1 One explanation is that MO programs hypothalamic regula- and -15 offspring hindleg muscle, and day-60 male offspring gastrocnemius tion of BW and energy homeostasis.MO in rats does muscle of CON, OB and MET dams slightly increase energy intake in offspring.Offspring of obese rat mothers are hyperphagic.However, in ourstudy, we only observed a trend toward a higher dietary mtDNA copy numbera intake in OB offspring compared with CON offspring, which could be because of our small sample size. Also, the diet used in our study differed from that in the published rat studies,and offspring may have distinctive preference for sugary and Citrate synthaseb fatty items in different diets. In addition, strain differences have been noted in the response to The observation that OB offspring showed more weight gain and adipositywhile lacking a significant difference in diet intake suggests that hyperphagia may not be the only cause of obesity but differences in basal energy expenditure may also contribute.
SM is the main tissue responsible for glucose and fatty acidoxidation. Reduction in SM oxidative capacity could lead to Abbreviations: b-HAD, b-hydroxyacyl-CoA dehydrogenase; Cyt C, cytochrome more offspring energy storage and BW gain. Mitochondria C oxidase II; mtDNA, mitochondrial DNA; UCP2, uncoupling protein 2.
amtDNA copy number was measured using Cyt C mtDNA gene compared with are the main sites of nutrient oxidation to generate ATP.
genomic UCP2 gene. bActivity was expressed in mmol per min per g wet Citrate synthase is a key enzyme in the tricarboxylic acid weight of muscle. Mean±s.e. *Po0.05 versus CON and #Po0.05 versus OB.
cycle, and b-HAD is a key enzyme in fatty acid oxidation.
Both enzymes are good markers of SM oxidative capacity.Our data showed that both mitochondrial content andfunction were impaired in OB offspring SM, indicating the evidenced by the decrease of citrate synthase activity and impairment of SM oxidative capacity. Maternal metformin b-HAD activity in OB offspring and restoration of their administration rescued mitochondrial density and function.
activity after maternal metformin administration In adult muscle, activation of AMPK enhances the oxidativecapacity of SM via a PPAR-g coactivator-1a-mediatedmechanism.Mitochondrial dysfunction leads to obesity,insulin resistance and type 2 diabetThus, our results support the notion that low oxidative capacity in muscle hasa role in the etiology of obesity.
Both obesity and diabetes are increasing at alarming rates AMPK has a critical role in maintaining systemic and and among a younger and younger MO cellular energy status. The growing appreciation that AMPK predisposes offspring to obesity and diabetes, which also coordinates anabolic and catabolic metabolic processes contributes to the increase in obesity, especially in children.
suggests that it may be an attractive target for preventing Nutrition and Diabetes Maternal obesity, metformin and offspring muscleJF Tong et al diabetes and related metabolic diseases. Physiological activa- Conflict of interest tion by exercise or pharmacological activation of AMPKimproves blood glucose disposal, lipid profile and blood The authors declared no conflict of interest.
pressure in insulin-resistant humans and rodents, whichindicates that AMPK is an effective drug target in thetherapeutic applications in diabetes and other metabolic Using a sheep MO model, we detected that MOdownregulates AMPK activity in fetal SM.This observation The research is supported by the National Institute of Child prompted us to investigate whether activation of AMPK in Health & Human Development: R01HD067449, and the fetal and neonatal SM could have a positive effect on its National Center for Research Resources of NIH and the development and function. In the present study, we elected to continue metformin administration throughout lactation and suckling, as SM development during this period in miceis approximately similar to the development that occurs from mid to late gestation in sheep and humans. Metforminreadily crosses the Metformin is commonly 1 Petersen KF, Dufour S, Shulman GI. Decreased insulin-stimulated used to treat type 2 diabetes, and its effect is believed to be ATP synthesis and phosphate transport in muscle of insulin-resistant offspring of type 2 diabetic parents. PLoS Med 2005; 2: mainly mediated by AMPK.Our data show that metformin administration during pregnancy and lactation 2 Galtier F, Raingeard I, Renard E, Boulot P, Bringer J. Optimizing increased AMPK activity in offspring SM of obese mothers.
the outcome of pregnancy in obese women: from pregestational b-Catenin is a key mediator of the canonical Wnt/ to long-term management. Diabetes Metab 2008; 34: 19–25.
3 Siega-Riz AM, Siega-Riz AM, Laraia B. The implications of b-catenin signaling pathway that is essential for myogenesis, maternal overweight and obesity on the course of pregnancy and blocking the b-catenin pathway reduces the total and birth outcomes. Matern Child Health J 2006; 10: 153–156.
number of MyoD and myogenin belong to 4 Morino K, Petersen KF, Dufour S, Befroy D, Frattini J, Shatzkes N the family of muscle-specific transcription factors that et al. Reduced mitochondrial density and increased IRS-1 serinephosphorylation in muscle of insulin-resistant offspring of type 2 control SM differentiation;their expression correlates with diabetic parents. J Clin Invest 2005; 115: 3587–3593.
myogenesis. We observed that b-catenin, MyoD and myo- 5 Fowden AL, Ward JW, Wooding FP, Forhead AJ, Constancia M.
genin were downregulated in fetal OB SM, which is Programming placental nutrient transport capacity. J Physiol consistent with our previous observation in sheep 2006; 572: 5–15.
6 Nathanielsz PW. Animal models that elucidate basic principles of PPAR-g is a critical regulator of adipogenesis. Increased the developmental origins of adult diseases. Ilar J 2006; 47: 73–82.
expression of PPAR-g leads to differentiation of pluripotent 7 Barker DJ. Fetal programming of coronary heart disease. Trends cells to Our observation of increased PPAR-g in Endocrinol Metab 2002; 13: 364–368.
OB offspring SM indicates that adipogenesis was upregu- 8 Armitage JA, Khan IY, Taylor PD, Nathanielsz PW, Poston L.
Developmental programming of the metabolic syndrome by lated, a conclusion confirmed by the presence of increased maternal nutritional imbalance: how strong is the evidence from numbers of intramuscular adipocytes in OB offspring SM, experimental models in mammals? J Physiol 2004; 561: 355–377.
detected in OB offspring SM. Maternal metformin adminis- 9 Zhu MJ, Han B, Tong J, Ma C, Kimzey JM, Underwood KR et al.
tration reversed these changes, indicating that metformin is AMP-activated protein kinase signalling pathways are downregulated and skeletal muscle development impaired in fetuses effective in improving SM development in fetuses and of obese, over-nourished sheep. J Physiol 2008; 586: 2651–2664.
neonatal mice born to obese mothers. Whether this 10 Tong JF, Yan X, Zhu MJ, Ford SP, Nathanielsz PW, Du M. Maternal beneficial effect is due to the positive impacts of metformin obesity downregulates myogenesis and beta-catenin signaling in on maternal whole-body energy metabolism, improved fetal skeletal muscle. Am J Physiol Endocrinol Metab 2009; 296:E917–E924.
insulin sensitivity and intrauterine environment or a direct 11 Lowell BB, Shulman GI. Mitochondrial dysfunction and type 2 action on the fetuses of metformin that has crossed the diabetes. Science 2005; 307: 384–387.
placenta remains to be clarified.
12 Ozanne SE, Jensen CB, Tingey KJ, Storgaard H, Madsbad S, Vaag AA.
Currently, metformin administration is avoided during Low birthweight is associated with specific changes in muscleinsulin-signalling protein expression. Diabetologia 2005; 48: 547–552.
human pregnancy because of the lack of data about its effects 13 Selak MA, Storey BT, Peterside I, Simmons RA. Impaired oxidative on fetal development.Our data show that metformin phosphorylation in skeletal muscle of intrauterine growth- administration during pregnancy and lactation has no retarded rats. Am J Physiol Endocrinol Metab 2003; 285: E130–E137.
obvious negative effect on overall fetal and offspring 14 Du M, Yan X, Tong JF, Zhao J, Zhu MJ. Maternal obesity, inflammation, and fetal skeletal muscle development. Biol Reprod 2010; 82: 4–12.
appeared healthy. In addition, our data clearly show that 15 Mermelstein CS, Portilho DM, Mendes FA, Costa ML, Abreu JG.
metformin administration during pregnancy and lactation Wnt/beta-catenin pathway activation and myogenic differentia- improves the development of fetal SM of obese mothers, tion are induced by cholesterol depletion. Differentiation 2007;75: 184–192.
which may provide a promising strategy to prevent the fetal- 16 Armstrong DD, Esser KA. Wnt/beta-catenin signaling activates programming effect of obesity during pregnancy on fetal and growth-control genes during overload-induced skeletal muscle offspring SM development.
hypertrophy. Am J Physiol 2005; 289: C853–C859.
Nutrition and Diabetes Maternal obesity, metformin and offspring muscle 17 Cossu G, Borello U. Wnt signaling and the activation of 35 Sparks LM, Xie H, Koza RA, Mynatt R, Hulver MW, Bray GA et al.
myogenesis in mammals. EMBO J 1999; 18: 6867–6872.
A high-fat diet coordinately downregulates genes required for 18 Yamanouchi K, Hosoyama T, Murakami Y, Nishihara M.
mitochondrial oxidative phosphorylation in skeletal muscle.
Myogenic and adipogenic properties of goat skeletal muscle stem Diabetes 2005; 54: 1926–1933.
cells. J Reprod Dev 2007; 53: 51–58.
36 Call JA, Voelker KA, Wolff AV, McMillan RP, Evans NP, Hulver MW 19 Pan W, Jia Y, Wang J, Tao D, Gan X, Tsiokas L et al. Beta-catenin et al. Endurance capacity in maturing mdx mice is markedly regulates myogenesis by relieving I-mfa-mediated suppression of enhanced by combined voluntary wheel running and green tea myogenic regulatory factors in P19 cells. Proc Natl Acad Sci USA extract. J Appl Physiol 2008; 105: 923–932.
2005; 102: 17378–17383.
37 Agbulut O, Noirez P, Beaumont F, Butler-Browne G. Myosin heavy 20 Spiegelman BM, Puigserver P, Wu Z. Regulation of adipogenesis chain isoforms in postnatal muscle development of mice.
and energy balance by PPARgamma and PGC-1. Int J Obes Relat Biol Cell 2003; 95: 399–406.
Metab Disord 2000; 24(Suppl 4): S8–S10.
38 Page KC, Malik RE, Ripple JA, Anday EK. Maternal and 21 Aguiari P, Leo S, Zavan B, Vindigni V, Rimessi A, Bianchi K et al.
postweaning diet interaction alters hypothalamic gene expres- High glucose induces adipogenic differentiation of muscle- sion and modulates response to a high-fat diet in male offspring.
derived stem cells. Proc Natl Acad Sci USA 2008; 105: 1226–1231.
Am J Physiol Regul Integr Comp Physiol 2009; 297: R1049–R1057.
22 Hardie DG. AMP-activated protein kinase: a key system mediat- 39 Kirk SL, Samuelsson AM, Argenton M, Dhonye H, Kalamatianos T, ing metabolic responses to exercise. Med Sci Sports Exerc 2004; 36: Poston L et al. Maternal obesity induced by diet in rats permanently influences central processes regulating food intake in offspring. PLoS 23 Hardie DG. New roles for the LKB1-AMPK pathway. Curr Opin One 2009; 4: e5870.
Cell Biol 2005; 17: 167–173.
40 Nivoit P, Morens C, Van Assche FA, Jansen E, Poston L, Remacle C 24 Jakobsen SN, Hardie DG, Morrice N, Tornqvist HE. 50-AMP- et al. Established diet-induced obesity in female rats leads activated protein kinase phosphorylates IRS-1 on Ser-789 in to offspring hyperphagia, adiposity and insulin resistance.
mouse C2C12 myotubes in response to 5-aminoimidazole-4- Diabetologia 2009; 52: 1133–1142.
carboxamide riboside. J Biol Chem 2001; 276: 46912–46916.
41 Samuelsson AM, Matthews PA, Argenton M, Christie MR, 25 Dagon Y, Avraham Y, Berry EM. AMPK activation regulates McConnell JM, Jansen EH et al. Diet-induced obesity in female apoptosis, adipogenesis, and lipolysis by eIF2alpha in adipocytes.
mice leads to offspring hyperphagia, adiposity, hypertension, and Biochem Biophys Res Commun 2006; 340: 43–47.
insulin resistance: a novel murine model of developmental 26 Habinowski SA, Witters LA. The effects of AICAR on adipocyte programming. Hypertension 2008; 51: 383–392.
differentiation of 3T3-L1 cells. Biochem Biophys Res Commun 2001; 42 Bruce CR, Anderson MJ, Carey AL, Newman DG, Bonen A, 286: 852–856.
Kriketos AD et al. Muscle oxidative capacity is a better predictor of 27 Giri S, Rattan R, Haq E, Khan M, Yasmin R, Won JS et al. AICAR insulin sensitivity than lipid status. J Clin Endocrinol Metab 2003; inhibits adipocyte differentiation in 3T3L1 and restores meta- 88: 5444–5451.
bolic alterations in diet-induced obesity mice model. Nutr Metab 43 Atherton PJ, Babraj J, Smith K, Singh J, Rennie MJ, Wackerhage H.
(Lond) 2006; 3: 31.
Selective activation of AMPK-PGC-1alpha or PKB-TSC2-mTOR 28 Hawley SA, Gadalla AE, Olsen GS, Hardie DG. The antidiabetic signaling can explain specific adaptive responses to endurance or drug metformin activates the AMP-activated protein kinase resistance training-like electrical muscle stimulation. FASEB J cascade via an adenine nucleotide-independent mechanism.
2005; 19: 786–788.
Diabetes 2002; 51: 2420–2425.
44 Suwa M, Egashira T, Nakano H, Sasaki H, Kumagai S. Metformin 29 Lee JO, Lee SK, Jung JH, Kim JH, You GY, Kim SJ et al. Metformin increases the PGC-1alpha protein and oxidative enzyme activities induces Rab4 through AMPK and modulates GLUT4 transloca- possibly via AMPK phosphorylation in skeletal muscle in vivo.
tion in skeletal muscle cells. J Cell Physiol 2010; 226: 974–981.
J Appl Physiol 2006; 101: 1685–1692.
30 Zou MH, Kirkpatrick SS, Davis BJ, Nelson JS, Wiles IV WG, 45 Hardie DG. Biochemistry. Balancing cellular energy. Science 2007; Schlattner U et al. Activation of the AMP-activated protein kinase 315: 1671–1672.
by the anti-diabetic drug metformin in vivo. Role of mito- 46 Feig DS. Metformin therapy for gestational diabetes mellitus: are chondrial reactive nitrogen species. J Biol Chem 2004; 279: we there yet? Nat Clin Pract Endocrinol Metab 2008; 4: 654–655.
47 Kovo M, Kogman N, Ovadia O, Nakash I, Golan A, Hoffman A.
31 Ma TC, Buescher JL, Oatis B, Funk JA, Nash AJ, Carrier RL et al.
Carrier-mediated transport of metformin across the human Metformin therapy in a transgenic mouse model of Huntington's placenta determined by using the ex vivo perfusion of the disease. Neurosci Lett 2007; 411: 98–103.
placental cotyledon model. Prenat Diagn 2008; 28: 544–548.
32 Folch J, Lees M, Sloane Stanley GH. A simple method for the 48 Paglia MJ, Coustan DR. The use of oral antidiabetic medications isolation and purification of total lipids from animal tissues. J Biol in gestational diabetes mellitus. Curr Diab Rep 2009; 9: 287–290.
Chem 1957; 226: 497–509.
49 Sabourin LA, Rudnicki MA. The molecular regulation of myogen- 33 Underwood KR, Tong J, Zhu MJ, Shen QW, Means WJ, Ford SP esis. Clin Genet 2000; 57: 16–25.
et al. Relationship between kinase phosphorylation, muscle fibertyping, and glycogen accumulation in longissimus muscle of beefcattle with high and low intramuscular fat. J Agric Food Chem This work is licensed under the Creative 2007; 55: 9698–9703.
34 Guo W, Jiang L, Bhasin S, Khan SM, Swerdlow RH. DNA Alike 3.0 Unported License. To view a copy of this mtDNA copy number determination. Mitochondrion 2009; 9: Supplementary Information accompanies the paper on the Nutrition and Diabetes website (http://www.nature.com/nutd) Nutrition and Diabetes

Source: http://vuir.vu.edu.au/30770/1/Metformin%20mitigates%20the%20impaired%20development%20of%20skeletal%20muscle%20in%20the%20offspring%20of%20obese%20mice.pdf